View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275_high_9 (Length: 251)
Name: NF1275_high_9
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 11113689 - 11113924
Alignment:
| Q |
1 |
atgagcattttacgaaattatggtgcgaggaagaaaatggtttagtcgggaggtctgctagttggtgacttgttgcatgagagaaacattgagttgcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11113689 |
atgagcattttacgaaattatggttcgaggaagaaaatggtttagtcgggaggtctgccaattggtgacttgttgcatgagagaaacattgagttgcttg |
11113788 |
T |
 |
| Q |
101 |
gcttctagcaggtcaggtaccaaatgataatttacgatcaagagttttatgtaggaatgaaatgaaggattattacatcaataagttgtctgagtaggtt |
200 |
Q |
| |
|
||| ||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
11113789 |
gctgctagcaggtcacgtgccaaatgataatttacgatcaagagtttcatgtaggaatgaaatgaagggttattacatcaataagttgtctgagtaggtt |
11113888 |
T |
 |
| Q |
201 |
ttaggtgtatcaatcaattgaacactgatttctagc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
11113889 |
ttaggtgtatcaatcaattgaacactgatttctagc |
11113924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University