View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275_low_2 (Length: 501)
Name: NF1275_low_2
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 2e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 13 - 154
Target Start/End: Original strand, 31045200 - 31045341
Alignment:
| Q |
13 |
aatatgaatatataaaataatcttttattagaaaataaaaattacatgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatttaagc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31045200 |
aatatgaatatataaaataatcttttattagaaaataaaaattacacgtacaaggaaaaagaatggtgaaacatgtactataattaagatcaatttaagc |
31045299 |
T |
 |
| Q |
113 |
ttatcttcaacaaaggtaattaactagcttggttggtaagta |
154 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31045300 |
ttatcttcaacaatggtaattaactagcttggttggtaagta |
31045341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University