View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1275_low_24 (Length: 309)

Name: NF1275_low_24
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1275_low_24
NF1275_low_24
[»] chr2 (1 HSPs)
chr2 (72-239)||(45170875-45171042)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 72 - 239
Target Start/End: Original strand, 45170875 - 45171042
Alignment:
72 gaacctgtgaaaaatatcaattggtgaccgagaacaacaagaaaaaagttatgactgtatttccttcnnnnnnngaagagaaatgactgtatttccttaa 171  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||    
45170875 gaacctgtgaaaaacatcaattggtgaccgagaacaacaagaaaaaagttatgactgtatttccttctttttttgaagagaaatgactgtatttccttaa 45170974  T
172 gtttcatcatgaattgcaaaaaagggcagcgaagtataatagtaatgtcatgcaataagacaaatatt 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
45170975 gtttcatcatgaattgcaaaaaagggcagcgaagtataatagtaatgtcatgcaataagacaaatatt 45171042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University