View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275_low_24 (Length: 309)
Name: NF1275_low_24
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275_low_24 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 72 - 239
Target Start/End: Original strand, 45170875 - 45171042
Alignment:
| Q |
72 |
gaacctgtgaaaaatatcaattggtgaccgagaacaacaagaaaaaagttatgactgtatttccttcnnnnnnngaagagaaatgactgtatttccttaa |
171 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45170875 |
gaacctgtgaaaaacatcaattggtgaccgagaacaacaagaaaaaagttatgactgtatttccttctttttttgaagagaaatgactgtatttccttaa |
45170974 |
T |
|
| Q |
172 |
gtttcatcatgaattgcaaaaaagggcagcgaagtataatagtaatgtcatgcaataagacaaatatt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45170975 |
gtttcatcatgaattgcaaaaaagggcagcgaagtataatagtaatgtcatgcaataagacaaatatt |
45171042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University