View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275_low_34 (Length: 251)
Name: NF1275_low_34
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275_low_34 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 24 - 251
Target Start/End: Original strand, 33517339 - 33517566
Alignment:
| Q |
24 |
gtagtttggacaatatctcgttacaaatggataaagtaaactataactcagtttattactagcttcccttacacctgataatcatttaatttgtgaaaat |
123 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33517339 |
gtagtttggacaatatttcgttacaaatggataaagtaaactataactcagtttattactagcttcccttacacctgataattatttaatttgtgaaaat |
33517438 |
T |
 |
| Q |
124 |
aataatcacacatgcatgcattgactatttttgttcatttgcttggcattgatagtttatttctataactaacttttattaagttagcatctctaatttt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33517439 |
aataatcacacatgcatgcattgactatttttgttcatttgcttggcattgatagtttatttctataactaacttttattaagttagcatctctaatttt |
33517538 |
T |
 |
| Q |
224 |
tgcaagtttgaacattacttccaataat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33517539 |
tgcaagtttgaacattacttccaataat |
33517566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University