View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275_low_41 (Length: 217)
Name: NF1275_low_41
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275_low_41 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 5e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 3244081 - 3243956
Alignment:
| Q |
1 |
taaaacaaatttccccgtaatagctcaaataacaagacattgtgtaagttacaaaacatttcttacttttaagacataagtataatccttgtaacttaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3244081 |
taaaacaaatttccccgtaatagctcaaataacaagacattgtgtaagttacaaatcatttcttacttttaagaca----tataatccttgtaacttaat |
3243986 |
T |
 |
| Q |
101 |
gaatggacatctttgtcacttgataatatt |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3243985 |
gaatggacatctttgtcacttgataatatt |
3243956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University