View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1275_low_50 (Length: 210)
Name: NF1275_low_50
Description: NF1275
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1275_low_50 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 1 - 130
Target Start/End: Complemental strand, 28529665 - 28529534
Alignment:
| Q |
1 |
tctgtcattctccagtcgatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaat--ttacaacnnnnnnnngtagcaggagag |
98 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |||||||||||| |
|
|
| T |
28529665 |
tctgtcattctccagtcaatagcaatacaattaaagtcctgcacacaatgaatgggaaatggtgagtaaattataacaacaaaagaaagtagcaggagag |
28529566 |
T |
|
| Q |
99 |
tactggcattttcatattgaaatattattcga |
130 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| |
|
|
| T |
28529565 |
tactggcattttcatattgaaatatttttcga |
28529534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University