View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12760_high_6 (Length: 293)
Name: NF12760_high_6
Description: NF12760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12760_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 28589483 - 28589765
Alignment:
| Q |
1 |
tagacagattcatagatagctctcatgtctggacacatcactagctagccaattaaatttatcacaaaaatgggagaatctctgctatgcaattgagcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28589483 |
tagacagattcatagatagctctcatgtctggacacatcactagctagccaattaaatttatcacaaaaatgggagaatctctgctatgcaattgagcca |
28589582 |
T |
|
| Q |
101 |
agaaatctaaagtagtttggaaatgatgtataactctagatactcaaaaccattaacannnnnnnnatttatagaaaacagaaataagagaaataaagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
28589583 |
agaaatctaaagtagtttggaaatgatgtataactctagatactcagaaccattaaca-tttttttatttatagaaaacagaaataagagaaataaagat |
28589681 |
T |
|
| Q |
201 |
atgaattgtcatcttggtttcaaaaatgataaattaatttattaaagttaaacattgttaatcagttcagttcttctttcatct |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28589682 |
atgaattgtcatcttggtttcaaaaatgataaattaatttattaaagttaaacattgttaatcagttcagttcttctttcatct |
28589765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University