View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12760_low_12 (Length: 226)
Name: NF12760_low_12
Description: NF12760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12760_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 16 - 78
Target Start/End: Original strand, 29541812 - 29541874
Alignment:
| Q |
16 |
cagaaatctctttataaacaagtcattagagtgagattggaatatagcatgtgaagtagccta |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29541812 |
cagaaatctctttataaacaagtcattagagtgagattggaatatagcatgtgaagtagccta |
29541874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University