View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12760_low_7 (Length: 436)
Name: NF12760_low_7
Description: NF12760
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12760_low_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 15 - 421
Target Start/End: Original strand, 29718125 - 29718529
Alignment:
| Q |
15 |
cacagaaaccgaatgaacattatggccgaggagaaattgttccaacagcaaatggttaccgccatcaatgggttggtgatgctgagcactctcttcaccg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29718125 |
cacagaaaccgaatgaacattatggccgaggagaaattgttccaacagcaaatggttaccgccatcaatgggttggtgatgctgagcaccctcttcaccg |
29718224 |
T |
|
| Q |
115 |
tggtgactatcatacttatgagcagcttcatgattgcatcctcacaaccaccatcgccaccaacaacagcgaaatggtacactatgttattcatgatgtg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29718225 |
tggtgactatcatacttatgagcagcttcatgattgcatcctcacaaccaccatcgccaccaacaacagcgaaatggtacactatgttattcatg--gtg |
29718322 |
T |
|
| Q |
215 |
ttatcattttgctgttttgttttaatgacggtcttgtctcttatcataaagcaaggattgatcatgcacaactacacgaacaaggttagaagctgctccg |
314 |
Q |
| |
|
||||||||||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29718323 |
ttatcattttgctgttttgttttcacgacggtattgtctcttatcataaagcaaggattgatcatgcacaactacacgaacaaggttagaagctgctccg |
29718422 |
T |
|
| Q |
315 |
tgcttggaataagcgcgattctgtgtgccggtctgcttcaatgtggcacctgctttctcctccaagctctattcaatatattttccatcattattggcat |
414 |
Q |
| |
|
|| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29718423 |
tgtttggaataagcgcgattctgtgtgccagtctgcttcaatgtggcacctgctttctcctccaagctctattcaatatactttccatcattattggcat |
29718522 |
T |
|
| Q |
415 |
taaattt |
421 |
Q |
| |
|
||||||| |
|
|
| T |
29718523 |
taaattt |
29718529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University