View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12761_low_6 (Length: 333)
Name: NF12761_low_6
Description: NF12761
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12761_low_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 85 - 317
Target Start/End: Original strand, 13871152 - 13871368
Alignment:
| Q |
85 |
gttgaaattttcattctttgaagttcacagtagcacctatgaagtaacaaatcatatacttactgaatttattcacactgtcaaattattagaacatatt |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || | | |
|
|
| T |
13871152 |
gttgaaattttcattctttgaagttcacagtagcacctatgaagtaacaaatcatatacttactgaatttattcacactgtcaaatt--taaaaaaaa-- |
13871247 |
T |
|
| Q |
185 |
cacactatcaaatttaagatagtttatagataatatgtctctaagtaaatttacaagcaaaatttaatctgagtacatttaaatgtctttgtcgcccaaa |
284 |
Q |
| |
|
||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13871248 |
--------caact----gatagtttatagataatatgtctctaagtaaatttacaagcaaaatttaaactgagtacatttaaatgtctttgtcgcccaaa |
13871335 |
T |
|
| Q |
285 |
cacatgatcaaagcaaatttcaatgttaaaact |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
13871336 |
cacatgatcaaagcaaatttcaatgttaaaact |
13871368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 15 - 84
Target Start/End: Original strand, 13870665 - 13870734
Alignment:
| Q |
15 |
ggagtggcagcgaaacaatgcaggtacggtggctttgatagaggagaagaggcgggaaaatgacattgag |
84 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
13870665 |
ggagtggcggcgaatcaatgcagttacggtggctttgatagaggagaagaggcgggaaaatgccattgag |
13870734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University