View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12762_high_19 (Length: 239)
Name: NF12762_high_19
Description: NF12762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12762_high_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 127 - 221
Target Start/End: Original strand, 21400749 - 21400843
Alignment:
| Q |
127 |
ggccctttccacgtctatatccaacccctgattttcgacgatcaacaacatttgtagagattggagaaagttctctagtaattaccagtttttcc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400749 |
ggccctttccacgtctatatccaacccctgattttccacgatcaacaacatttgtagagattggagaaagttctctagtaattaccagtttttcc |
21400843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 1 - 91
Target Start/End: Original strand, 21400659 - 21400749
Alignment:
| Q |
1 |
tgcattcctcaagcctgatgttgattgaacctgtcctgagccctggagggtaaccacgtttcttgtagcacacttcaacaatctgacctag |
91 |
Q |
| |
|
||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21400659 |
tgcattcctcaagactgatgttgattgaatcggtcctgagccctggagggtaaccacgtttcttgtagcacacttcaacaatctgacctag |
21400749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University