View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12762_high_8 (Length: 378)
Name: NF12762_high_8
Description: NF12762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12762_high_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 348
Target Start/End: Complemental strand, 49703526 - 49703179
Alignment:
| Q |
1 |
atcttctggtattggactaacaggtgctatttgtttgttttctttaatgttttggaatatattttgaatttcgtcgtggccttgattttctgccaaagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
49703526 |
atcttctggtattggactaacaggtgctgtttgtttgttttctttaatgttttggaatatatttttaatttcatcgtggccttgattttctgccaaagcc |
49703427 |
T |
|
| Q |
101 |
cttggagtccagccatgatcatcttgcatatcaacttcagctcctaggtccaaaaggaactttaccatctctacatttctgtcacttactgctttatgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703426 |
cttggagtccagccatgatcatcttgcatatcaactttagctcctaggtccaaaaggaactttaccatctctacatttctgtcacttactgctttatgca |
49703327 |
T |
|
| Q |
201 |
gggcagtgattccgctcatttcgggttttgtcacatccacgccgagttctttgagttccttaagcaattcaatgctatttttatcaactgcagagcatgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703326 |
gggcagtgattccgctcatttcgggttttgtcacatccacaccgagttctttgagttccttaagcaattcaatgctatttttatcaactgcagagcatgc |
49703227 |
T |
|
| Q |
301 |
tagatgccctgcatcaacacaaaatatgtctgcacccttgtctatgag |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703226 |
tagatgccctgcatcaacacaaaatatgtctgcacccttgtctatgag |
49703179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University