View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12762_low_10 (Length: 360)
Name: NF12762_low_10
Description: NF12762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12762_low_10 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 20 - 360
Target Start/End: Complemental strand, 49703695 - 49703355
Alignment:
| Q |
20 |
cagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgactatctaaccatggcaactcttcttgattaggtggttgtagcat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703695 |
cagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgactatctaaccatggcaactcttcttgattaggtggttgtagcat |
49703596 |
T |
 |
| Q |
120 |
gttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacacattaggcgtaccatcttctggtattggactaacaggtgctatt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
49703595 |
gttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacacattaggcgtaccatcttctggtattggactaacaggtgctgtt |
49703496 |
T |
 |
| Q |
220 |
tgtttgttttctttaatgttttggaatatattttgaatttcgtcgtggccttgattttctgccaaagcccttggagtccagccatgatcatcttgcatat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703495 |
tgtttgttttctttaatgttttggaatatatttttaatttcatcgtggccttgattttctgccaaagcccttggagtccagccatgatcatcttgcatat |
49703396 |
T |
 |
| Q |
320 |
caacttcagctcctaggtccaaaaggaactttaccatctct |
360 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49703395 |
caactttagctcctaggtccaaaaggaactttaccatctct |
49703355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University