View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12762_low_18 (Length: 240)

Name: NF12762_low_18
Description: NF12762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12762_low_18
NF12762_low_18
[»] chr3 (1 HSPs)
chr3 (11-222)||(49703527-49703738)


Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 49703738 - 49703527
Alignment:
11 agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49703738 agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac 49703639  T
111 tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
49703638 tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac 49703539  T
211 attaggcgtacc 222  Q
    ||||||||||||    
49703538 attaggcgtacc 49703527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University