View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12762_low_18 (Length: 240)
Name: NF12762_low_18
Description: NF12762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12762_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 11 - 222
Target Start/End: Complemental strand, 49703738 - 49703527
Alignment:
| Q |
11 |
agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703738 |
agatgaatgatgtaagtgatatactacttaccgtaattggcagcagatatcatcccgaaaattgaattatgaaaggtgttggccctttgcctccgatgac |
49703639 |
T |
 |
| Q |
111 |
tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49703638 |
tatctaaccatggcaactcttcttgattaggtggttgtagcatgttatctagggatccacgagcatcaggcataacgggtgcactttgaaacgacgacac |
49703539 |
T |
 |
| Q |
211 |
attaggcgtacc |
222 |
Q |
| |
|
|||||||||||| |
|
|
| T |
49703538 |
attaggcgtacc |
49703527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University