View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12765_high_23 (Length: 234)

Name: NF12765_high_23
Description: NF12765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12765_high_23
NF12765_high_23
[»] chr3 (1 HSPs)
chr3 (1-212)||(52164490-52164701)
[»] chr1 (1 HSPs)
chr1 (55-178)||(6635652-6635775)


Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 52164490 - 52164701
Alignment:
1 atggaatttgaggtaggggaaggaggttatgattgcggcgcgtagattgaacgcgtttgatgaacaaacgaagtggaagaatatgttttgtggacatgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52164490 atggaatttgaggtaggggaaggaggttatgattgcggcgcgtagattgaacgcgtttgatgaacaaacgaagtggaagaatatgttttgtggacatgat 52164589  T
101 gaatgttggaggattgataagattgcagccatggatcctcggatatatgttgtgtcgagtgtcattgctacttggactactgttgattttgaagtgtcgg 200  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52164590 gaatgttggaggattgataagattgctgccatggatcctcggatatatgttgtgtcgagtgtcattgctacttggactactgttgattttgaagtgtcgg 52164689  T
201 taatggaagggc 212  Q
    ||||||||||||    
52164690 taatggaagggc 52164701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 55 - 178
Target Start/End: Original strand, 6635652 - 6635775
Alignment:
55 gtttgatgaacaaacgaagtggaagaatatgttttgtggacatgatgaatgttggaggattgataagattgcagccatggatcctcggatatatgttgtg 154  Q
    |||||| |||||||| ||||| ||||  |||||||||||||||||||| ||||||||||  || | ||||||||||||||||||||||||||||||||||    
6635652 gtttgaggaacaaacaaagtgaaagatgatgttttgtggacatgatgagtgttggaggacagagaggattgcagccatggatcctcggatatatgttgtg 6635751  T
155 tcgagtgtcattgctacttggact 178  Q
    || | ||||||||| || ||||||    
6635752 tctaatgtcattgccacatggact 6635775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University