View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12765_low_18 (Length: 318)
Name: NF12765_low_18
Description: NF12765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12765_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 307
Target Start/End: Original strand, 4932856 - 4933144
Alignment:
| Q |
19 |
ctttcgactgaacggtacgagacattcgtcgcataattcttaggttcttcactaggaaccgccaccgctttattacgatcttcatgaattttttccaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
4932856 |
ctttcgactgaacggtacgagacattggtcgcataattcttaggttcttcactaggaaccaccaccgctttattatgatcttcatgaattttgtccaatg |
4932955 |
T |
|
| Q |
119 |
tatttgtattgacatttgtcgatgttttggttttatcatggtcatcgtccttcaaaactaaatctattttttgttttgatgttttaatattgtccttccc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
4932956 |
tatttgtattgacatttgtcgatgttttggttttatcatggtcatcgtccttcaaaactaaatctattttttcttttgatgttttaatattgtccttccc |
4933055 |
T |
|
| Q |
219 |
caaaggcaaatttgtcgtttcatctaatgcatctattgagccatgagacgagtccggcgacatagaatgtctctccttatccacttcat |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4933056 |
caaaggcaaatttgtcgtttcatctaatgcatctattgagccataagacgagtccggcgacatagaatgtctctccttacccacttcat |
4933144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University