View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12765_low_21 (Length: 283)
Name: NF12765_low_21
Description: NF12765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12765_low_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 36955766 - 36955941
Alignment:
| Q |
1 |
acacatagatgtattaatgtttgcaacttctcacatggactacacttaaatctgctggtgcaaagcgacatcctagaaaagtactagcacttcatattga |
100 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
36955766 |
acacatagatgtattaatgtttgcagcttctcacatggactgcacttaaatctgctggtgcaaagcgaagttctagaaaagtactagcacttcatattga |
36955865 |
T |
|
| Q |
101 |
atccaaaccaagcaattcaaattcatcagaaacagaatcaaataaagaccaaaatgaagacaatgctgaagcatct |
176 |
Q |
| |
|
||||||||||||| |||||||||||||| ||| ||||||| ||| |||||||||||||||||||| |||||||||| |
|
|
| T |
36955866 |
atccaaaccaagcgattcaaattcatcaaaaatagaatcagatatagaccaaaatgaagacaatgttgaagcatct |
36955941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University