View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12765_low_23 (Length: 245)

Name: NF12765_low_23
Description: NF12765
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12765_low_23
NF12765_low_23
[»] chr6 (1 HSPs)
chr6 (13-231)||(1724320-1724538)


Alignment Details
Target: chr6 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 13 - 231
Target Start/End: Original strand, 1724320 - 1724538
Alignment:
13 gttcactttaacaaaagattcctttggctttttcaaaagaaaaaactattatagttgaaataataagaatttaagtatcattggtacataattcatttat 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1724320 gttcactttaacaaaagattcctttggctttttcaaaagaaaaaactattatagttgaaataataagaatttaagtatcattggtacataattcatttat 1724419  T
113 aatttgtcaaaactaaaatggaaaaatgaactgaaaatgttgagaatatggtaccattagaaatttcagaatagacatataaggaaatggaataatgtgg 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1724420 aatttgtcaaaactaaaatggaaaaatgaactgaaaatgttgagaatatggtaccattagaaatttcagaatagacatataaggaaatggaataatgtgg 1724519  T
213 gaattacgcgtccatactg 231  Q
    |||||||||||||||||||    
1724520 gaattacgcgtccatactg 1724538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University