View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12766_high_11 (Length: 230)
Name: NF12766_high_11
Description: NF12766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12766_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 109 - 206
Target Start/End: Original strand, 7406031 - 7406129
Alignment:
| Q |
109 |
caccacatatacttgctgttgagagtgtagacttgactctccccacccaattatcattccaaaac-aaagttgatgacatctcttaggttagttggagg |
206 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7406031 |
caccacatatactagttgttgagagtgtagacttgactctccccacccaattatcattccaaaacaaaagttgatgacatctcttaggttagttggagg |
7406129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 13 - 106
Target Start/End: Original strand, 7405899 - 7405994
Alignment:
| Q |
13 |
atcatcatcatatattattgtctaaacat--atacatttaacgaataatattaatatgactcgaaaattaaataacaaacttaaggtgttatattc |
106 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||| ||||||||| |||||||||||||| |||||||||||| | |||||||| |||| |
|
|
| T |
7405899 |
atcatcatcatatattaatgtctaaacattgatacatttaactaataatatttatatgactcgaaaagtaaataacaaacatgaggtgttacattc |
7405994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University