View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12766_high_9 (Length: 269)
Name: NF12766_high_9
Description: NF12766
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12766_high_9 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 2510 - 2772
Alignment:
| Q |
1 |
tctagctgctttcctttagtagagcccacttacctaccatctacaccaatctcgaaatcatttcctttgcttcctatattagtatccgacgcattcactt |
100 |
Q |
| |
|
||||||||||||||||| ||||| |||| || |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2510 |
tctagctgctttcctttggtagatcccattttcctaccatctacaccattctcgaaatcatttcctttgcttcctatattagtatccgacgcattcactt |
2609 |
T |
 |
| Q |
101 |
ttgagtttggatttagaacacccttcatgtacctagatgcaacagaaaccttttcttctttaataacaatcttctgccttgaacttgtgttctctttggc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2610 |
ttgagtttggatttagaacacccttcatgtacctagatgcaacagaaaccttttcttctttaataacaatcttctgccttgaacttgtgttctctttggc |
2709 |
T |
 |
| Q |
201 |
ttctattttatcggtcgattttgaaccatcaactccatcgttttcaggatgcattcttctctc |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2710 |
ttctattttatcggtcgattttgaaccatcaactccatcgttttcaggatgcattctactctc |
2772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University