View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_high_13 (Length: 451)
Name: NF12767_high_13
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_high_13 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 348; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 348; E-Value: 0
Query Start/End: Original strand, 48 - 440
Target Start/End: Original strand, 8932014 - 8932405
Alignment:
| Q |
48 |
tactaaacatataaactcaatgtagcaaatcaaaacctcgctgtaaaatggtcaatacaagcagcatttgatagaataaattatcaaacaaaccttttca |
147 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8932014 |
tactaaacaaataaactcaatgtagcaaatcaaaacctcgctgtaaaatggtcaatacaagcagcatttgatagaataaataatcaaacaaaccttttca |
8932113 |
T |
|
| Q |
148 |
agttatcatgggagcaaaacattgcaacaacatattcatttgatagcaagagaacaagaacaatagactaatctttggtttgtgaaattaattattggaa |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8932114 |
agttatcatgggagcaaaacattgcaacaacatattcatttgatagcaagagaacaagaacaatagactaatctttggtttgtgaaattaattattggaa |
8932213 |
T |
|
| Q |
248 |
actcaatcnnnnnnnntaatattcagaaataatttgcttatggtagaatttcatgggaaaacagctgcagaactatccaaaattttcaatttgtgtttaa |
347 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8932214 |
actcaatc-aaaaaaataatattcagaaataatttgcttatggtagaatttcatgggaaaacagctgcagaactatccaaaattttcaatttgtgtttaa |
8932312 |
T |
|
| Q |
348 |
aaggattccagaacagaagttcattttgagctcaaattatgaaggaaattctatccatgggcttcattggagacacatcattctttcatctca |
440 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8932313 |
aaggattccagaacagaagttcattttgagctcaaattatgaaggaaattctgtccataggcttcattggagacacatcattctttcatctca |
8932405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University