View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_high_17 (Length: 395)
Name: NF12767_high_17
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_high_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 232 - 384
Target Start/End: Complemental strand, 39701797 - 39701645
Alignment:
| Q |
232 |
tttaaattatcttatggttgaggaggttttaaataagccatcttcattgatcaatttaaattgtgatttttaaatggtgtctatcatacccaaggtaatt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39701797 |
tttaaattatcttatggttgaggaggttttaaataagccatcttcattgatcaatttaaattgtgatttttaaatggtgtctatcatacccaaggtaatt |
39701698 |
T |
 |
| Q |
332 |
aaaattggatcaaattgatcggtatggtcggttgaaccgaaaattgaacctat |
384 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39701697 |
aaaattggaccaaattgatcggtatggtcggttgaaccgaaaattgaacctat |
39701645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 64 - 200
Target Start/End: Complemental strand, 39702111 - 39701973
Alignment:
| Q |
64 |
ttgctaactttctgatttttt-atttattattgttatatccaaaaacttaacttaagttttttgaacgattagtctttgttgaatctctttaaccttgag |
162 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
39702111 |
ttgctaactttctgatttttttaattattattgttatatccaaaaacttaacttaagttttttgaacgattggtctttgttgaaactctttaaccttgag |
39702012 |
T |
 |
| Q |
163 |
tctagtcaattacataataatttaaaaaa-gatttgtct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
39702011 |
tctagtcaattacataataatttaaaaaaggatttgtct |
39701973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University