View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_high_31 (Length: 262)
Name: NF12767_high_31
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_high_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 35074516 - 35074373
Alignment:
| Q |
1 |
agaagcttctccttgatctctctgttgttgcggctgcatcgtttctacctcaatcatgatagcttatgattttatttgttttcagcttttgaaacgcgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074516 |
agaagcttctccttgatctctctgttgttgcggctgcatcgtttctacctcaatcatgatagcttatgattttatttgttttcagcttttgaaacgcgat |
35074417 |
T |
|
| Q |
101 |
tccgttggctttatttattttttgtgttatctcacagctattga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35074416 |
tccgttggctttatttattttttgtgttatctcacagctattga |
35074373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 243
Target Start/End: Complemental strand, 35074319 - 35074274
Alignment:
| Q |
198 |
tatgtggagaggttgtgggttgagatatataggatgtgatcaaatt |
243 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35074319 |
tatgtggagaggttgtgggttgggatatataggatgtgatcaaatt |
35074274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University