View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12767_high_32 (Length: 250)

Name: NF12767_high_32
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12767_high_32
NF12767_high_32
[»] chr4 (1 HSPs)
chr4 (19-95)||(53562508-53562584)


Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 95
Target Start/End: Original strand, 53562508 - 53562584
Alignment:
19 gtgctgctggtttttctgtttgcagcagctcttatgctttctgtgttgctgctctgcgtgttctgctgtatgcatca 95  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
53562508 gtgctgctggtttttctgtttgcagcagctcttatgctttctgtgttgctgctctgcgtgttttgctgtatgcatca 53562584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University