View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_high_36 (Length: 238)
Name: NF12767_high_36
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_high_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 27 - 221
Target Start/End: Complemental strand, 7427351 - 7427157
Alignment:
| Q |
27 |
tgtaagcgacctaatggttcaacgaacttgttacaaaaaactcattgattatattcatagttttgggaaaagagtgagttaacggaggaaagtaagcgta |
126 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||| |||||| |||| || |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7427351 |
tgtaagtgacctaatgattcaacgaacttgttaccaaaaacacattcataatattcatagttttgggaaaagagggagttaacggaggaaagtaagcgta |
7427252 |
T |
 |
| Q |
127 |
aggctcgagactaaaatgtggaagctgcgatgagaaattgcatcactaaatcatttccttcgtctcaataaaatacaattagacacatcaatctc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7427251 |
aggctcgagactaaaatgtggaagctgcgatgagaaattgcatcactaaatcatttccttcgtctcaataaaatacaattagacacatcaatctc |
7427157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University