View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12767_high_36 (Length: 238)

Name: NF12767_high_36
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12767_high_36
NF12767_high_36
[»] chr1 (1 HSPs)
chr1 (27-221)||(7427157-7427351)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 27 - 221
Target Start/End: Complemental strand, 7427351 - 7427157
Alignment:
27 tgtaagcgacctaatggttcaacgaacttgttacaaaaaactcattgattatattcatagttttgggaaaagagtgagttaacggaggaaagtaagcgta 126  Q
    |||||| ||||||||| ||||||||||||||||| |||||| |||| || |||||||||||||||||||||||| |||||||||||||||||||||||||    
7427351 tgtaagtgacctaatgattcaacgaacttgttaccaaaaacacattcataatattcatagttttgggaaaagagggagttaacggaggaaagtaagcgta 7427252  T
127 aggctcgagactaaaatgtggaagctgcgatgagaaattgcatcactaaatcatttccttcgtctcaataaaatacaattagacacatcaatctc 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7427251 aggctcgagactaaaatgtggaagctgcgatgagaaattgcatcactaaatcatttccttcgtctcaataaaatacaattagacacatcaatctc 7427157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University