View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_high_39 (Length: 213)
Name: NF12767_high_39
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_high_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 21 - 200
Target Start/End: Complemental strand, 35338353 - 35338174
Alignment:
| Q |
21 |
tacattgcccctggtgagaattcattcaaatacattctattttctttttcctcttcaatcattgttgcattttatacaaggttttatgccgatgttattt |
120 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
35338353 |
tacattgcccctggtgagaattcatccaaacacattctattttatttttcatcttcaatcattgttgcattttatacaaggttttatgctgatgttattt |
35338254 |
T |
|
| Q |
121 |
tttatttattggtcatgtttagccatagttggacagattgaaccatgacttagagatctcattggctagttcaatctctg |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35338253 |
tttatttatttgtcatgtttagccatagttggaccgattgaaccatgacttagagatctcattagctagttcaatctctg |
35338174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University