View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_low_26 (Length: 306)
Name: NF12767_low_26
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 14 - 295
Target Start/End: Complemental strand, 10596802 - 10596521
Alignment:
| Q |
14 |
actagcctttgatgcactcttaccatttgaatttggttcaatcctgtctttgatgtctctcaaaggaatgttctttgattcaacagatgttgctttcgag |
113 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||||||||||||| || |
|
|
| T |
10596802 |
actagcctttggtgcactcttactatctgaatttggttcagtcctgtctttgatgtctctcaaaggaatgttctttgatccaaaagatgttgctttcaag |
10596703 |
T |
 |
| Q |
114 |
tgttcttttgaagcaggtggacttggagaccttgaacttccatttccatttttcttccttggcaatggatcaactctcagacaaacaggaggtaacttgg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10596702 |
tgttcttttgaagcaggtggacttggagaccttgaactcccatttccatttttcttccttggcaatggatcaactctcagacaaacaggaggtaacttgg |
10596603 |
T |
 |
| Q |
214 |
atcccttaggcggagatgttgattgtcgtttactcatcgagttagagtcnnnnnnngtcacattctctttggcatcattcat |
295 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
10596602 |
atcccttaggcggagatgttggtcgtcgtttactcatcgagttagagtctttttttgtcacattctctttggcatcattcat |
10596521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University