View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12767_low_33 (Length: 262)

Name: NF12767_low_33
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12767_low_33
NF12767_low_33
[»] chr3 (2 HSPs)
chr3 (1-144)||(35074373-35074516)
chr3 (198-243)||(35074274-35074319)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 144
Target Start/End: Complemental strand, 35074516 - 35074373
Alignment:
1 agaagcttctccttgatctctctgttgttgcggctgcatcgtttctacctcaatcatgatagcttatgattttatttgttttcagcttttgaaacgcgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35074516 agaagcttctccttgatctctctgttgttgcggctgcatcgtttctacctcaatcatgatagcttatgattttatttgttttcagcttttgaaacgcgat 35074417  T
101 tccgttggctttatttattttttgtgttatctcacagctattga 144  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
35074416 tccgttggctttatttattttttgtgttatctcacagctattga 35074373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 198 - 243
Target Start/End: Complemental strand, 35074319 - 35074274
Alignment:
198 tatgtggagaggttgtgggttgagatatataggatgtgatcaaatt 243  Q
    |||||||||||||||||||||| |||||||||||||||||||||||    
35074319 tatgtggagaggttgtgggttgggatatataggatgtgatcaaatt 35074274  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University