View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_low_35 (Length: 249)
Name: NF12767_low_35
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 738866 - 739098
Alignment:
| Q |
1 |
aacataataacaaaacatatatacctaaatgcctcttagaaatactttaaattgtggccgtaacataacgattttagaggtcaaataaattgcaattacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
738866 |
aacataataacaaaacatatatacctaaatgcctcttagaaatagtttaaattgtggccgtaacataacgattttagaggtcaaataaattgcaattacg |
738965 |
T |
|
| Q |
101 |
gtcagatataagccgcatttgcctgcattttaccgcaatttaaaacagatatatttggagtgaggggaacttactgatagtgtcgccgatttggaagttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
738966 |
gtcagatataagccgcatttgcctgcattttaccgcaatttaaaacag--atatttggagtgaggggaacttaccgatagtgtcgccgatttggaagttc |
739063 |
T |
|
| Q |
201 |
ttagtagcagcccatttcttgtaatctatactacc |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
739064 |
ttagtagcagcccatttcttgtaatctatactacc |
739098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 169 - 223
Target Start/End: Complemental strand, 47218922 - 47218868
Alignment:
| Q |
169 |
acttactgatagtgtcgccgatttggaagttcttagtagcagcccatttcttgta |
223 |
Q |
| |
|
||||||| |||||||| || | |||||||||||| |||||||||||||| ||||| |
|
|
| T |
47218922 |
acttactaatagtgtcaccaagttggaagttcttggtagcagcccattttttgta |
47218868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University