View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_low_37 (Length: 243)
Name: NF12767_low_37
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_low_37 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 19 - 206
Target Start/End: Original strand, 738641 - 738828
Alignment:
| Q |
19 |
gcaatggccaggaatgccacacaagaaaaaatgatgaccataatttgttatttttatggagtctttgccagtggagaaggttgttaaaggggatgatcca |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
738641 |
gcaatggccaggaatgccacacaagaaaaaatgatgaccataatttgttatctttatggagtctttgccagtggagaaggttgttaaaggggatgatcca |
738740 |
T |
|
| Q |
119 |
ttgcatgacttgtacatagcgtgtgtcacacgcatcacattgtggaattgagaattgtattcaaaaactggtgaaacaaattaccaaa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
738741 |
ttgcatgacttgtacatagcgtgtgtcacacgcatcacattgtggaattgagaattgtattcaaaaactggtgaaacaaattaccaaa |
738828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 35 - 167
Target Start/End: Complemental strand, 47219804 - 47219672
Alignment:
| Q |
35 |
ccacacaagaaaaaatgatgaccataatttgttatttttatggagtctttgccagtggagaaggttgttaaaggggatgatccattgcatgacttgtaca |
134 |
Q |
| |
|
||||| ||||| || |||||||||| ||||||||| ||||||| ||| || ||||||| ||| |||| || ||| |||||| |||||||||||||||||| |
|
|
| T |
47219804 |
ccacagaagaagaagtgatgaccatgatttgttatctttatggtgtcatttccagtggtgaatgttgctataggtgatgatgcattgcatgacttgtaca |
47219705 |
T |
|
| Q |
135 |
tagcgtgtgtcacacgcatcacattgtggaatt |
167 |
Q |
| |
|
| || |||||||| ||||||||||||||||||| |
|
|
| T |
47219704 |
tggcatgtgtcactcgcatcacattgtggaatt |
47219672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University