View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12767_low_39 (Length: 228)
Name: NF12767_low_39
Description: NF12767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12767_low_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 18 - 211
Target Start/End: Original strand, 4049811 - 4050003
Alignment:
| Q |
18 |
cttacgatagtagataagctcgaataggccaatcaaagaacaggtgcaaacttaaaatgaatttgagaatgaaatttgtcaaacacaatatactagatca |
117 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4049811 |
cttatgatactagataagctcgaataggccaatcaaagaacaggtgcaaacttaaaatgaatttgaaaatgaaatttgtcaaacacaatatactagatca |
4049910 |
T |
 |
| Q |
118 |
aaaatagggattcacactcttaaaagaaatatttggaaaatcagttctataccttatcctgctctagcttcttgaggatatcactcctagctct |
211 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4049911 |
aaaatagtgattcacactctt-aaagaaatatttggaaaatcagttctataccttatcctgctctagcttcttgaggatgtcactcctagctct |
4050003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University