View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12769_high_9 (Length: 259)
Name: NF12769_high_9
Description: NF12769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12769_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 10187948 - 10188181
Alignment:
| Q |
18 |
aagaggaatgaaaatgaatgtattataaatgctatagtattttatttgacatttttgttgaagagttacatcatctgttatacagttttcttttgctttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10187948 |
aagaggaatgaaaatgaatgtattataaatgctatagtattttatttgacatttttgttgaagagttacatcatctgttatacagttttcttttgctttg |
10188047 |
T |
 |
| Q |
118 |
ttcaactatcactttggtgtctcttacatcttttgagtggactaattgttcatataggcatagctcaagtagttgtactatgttatttgagtttagtctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10188048 |
ttcaactatcactttggtgtctcttacatcatttgagtggactaattgttcatataggcatagctcaagtagttgtactatgttatttgagtttagtctc |
10188147 |
T |
 |
| Q |
218 |
tnnnnnnnttaccaaattatttgccttcatattt |
251 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
10188148 |
taaaaaaattaccaaattatttgccttcatattt |
10188181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University