View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12769_low_6 (Length: 307)
Name: NF12769_low_6
Description: NF12769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12769_low_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 44632494 - 44632200
Alignment:
| Q |
1 |
cagagagtgtgacagtatatacccataactaccaacctgctacattttactacaatgcttttatccctaatggtgtttggtatggttttgattattgtcg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44632494 |
cagagagtgtgacagtatatacccataactaccaacctgctactttttactacaatgcttttatccctaatggtgtttggtatggttttgattattgtcg |
44632395 |
T |
 |
| Q |
101 |
tggttacttaccctccactgctactgct---------gctgctgcactctagtgtagttgatcttcttagtttatgaataagataataatgtagttttcc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44632394 |
tggttacttaccctccactgctactgctactgctgctgctgctgcactctagtgtagttgatcttcttagtttatgaataagataataatgtagttttcc |
44632295 |
T |
 |
| Q |
192 |
aactgtgaaaccctctgttatatgcgggattagtggtccttctataagcccttcttttacatggaaatgtttgtttgtaggttttactgtctgtg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44632294 |
aactgtgaaaccctctgttatatgcgggattagtggtccttctataagcccttcttttatatggaaatgtttgtttgtaggttttactgtctgtg |
44632200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University