View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12769_low_8 (Length: 260)
Name: NF12769_low_8
Description: NF12769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12769_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 31 - 133
Target Start/End: Original strand, 3342923 - 3343025
Alignment:
| Q |
31 |
aaaaaagatgatttatcatgcaagattctcgttattggcatcgttagtctattaattttatgcaaatagataacgacaagaactatgggattgttcaata |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342923 |
aaaaaagatgatttatcatgcaagattctcgttattggcatcgttagtctattaattttatgcaaatagataacgacaagaactatgggattgttcaata |
3343022 |
T |
 |
| Q |
131 |
ggt |
133 |
Q |
| |
|
||| |
|
|
| T |
3343023 |
ggt |
3343025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 173 - 207
Target Start/End: Original strand, 3343065 - 3343099
Alignment:
| Q |
173 |
tttgcaattgttgttgggatacaacaacagttagc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3343065 |
tttgcaattgttgttgggatacaacaacagttagc |
3343099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University