View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1276_low_20 (Length: 231)
Name: NF1276_low_20
Description: NF1276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1276_low_20 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 11 - 107
Target Start/End: Original strand, 44830492 - 44830588
Alignment:
| Q |
11 |
ttgagactaacaataggcatacattccaatattttgataaaagtgcatatcaaatctggtaattgggattgaccatccatacttttctagactctct |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44830492 |
ttgagactaacaataggtatacattccaatattttgataaaagtgcatatcaaatctggtaattgggattgaccatccatacttttctagactctct |
44830588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 195 - 231
Target Start/End: Complemental strand, 26335892 - 26335856
Alignment:
| Q |
195 |
ttggtgatctccatccccaatactttgctgcacaaca |
231 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
26335892 |
ttggtgatctcaatcccaaatactttgctgcacaaca |
26335856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University