View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1276_low_22 (Length: 203)
Name: NF1276_low_22
Description: NF1276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1276_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 47170177 - 47170298
Alignment:
| Q |
1 |
catgtctggttgggctattgctgttcatggcggcgcaggtgtggatcctaacctgccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47170177 |
catgtctggttgggctattgctgttcatggcggtgcaggtgtggatcctaacctcccaccacaccgtcagcaagaagccaaacagcttcttaccgaatgt |
47170276 |
T |
|
| Q |
101 |
ctcaatctcggtatctctgctc |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
47170277 |
ctcaatctcggtatctctgctc |
47170298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 7 - 93
Target Start/End: Complemental strand, 42165733 - 42165647
Alignment:
| Q |
7 |
tggttgggctattgctgttcatggcggcgcaggtgtggatcctaacctgccaccacaccgtcagcaagaagccaaacagcttcttac |
93 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| |||||||||||||| || |||||||| |||||| ||||||||||||| |||||||| |
|
|
| T |
42165733 |
tggttgggctattgctgtgcatggtggcgccggtgtggatcctaatctcccaccacaacgtcaggaagaagccaaacaacttcttac |
42165647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University