View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1276_low_3 (Length: 496)
Name: NF1276_low_3
Description: NF1276
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1276_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 256; Significance: 1e-142; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 70 - 386
Target Start/End: Original strand, 8154954 - 8155270
Alignment:
| Q |
70 |
atgtcgaataatatggccggaaaataaaatctgactatataactagtttggattacatggaaatggattatactttatttttgagtctttgcattcgaat |
169 |
Q |
| |
|
|||||||| | |||||||| |||||||||||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8154954 |
atgtcgaaaattatggccgaaaaataaaatctaactatttaactagttttgattacatggaaatggattatactttatttttgagtctttgcattcgaat |
8155053 |
T |
|
| Q |
170 |
gtcctcaagtataagacgtgtctctctgcgtgcctcattactacattgtctataacatagtactannnnnnnggtagagatctctaattctttcatctca |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |||||||||||||||||||||||||||| |
|
|
| T |
8155054 |
gtcctcaagtataagacgtgtctctctgcgtgcctcattactacattgtctataacattgtaccatttttttggtagagatctctaattctttcatctca |
8155153 |
T |
|
| Q |
270 |
tccaaaactatttgtctgttcctgcactctatgctgcagaaaccttgatctcccctgcataataattaccaacataatgtttcatcagatcaaggttaaa |
369 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8155154 |
tctaaaactatttgtctgttcctgcactctatactgcagaaaccttgatctcccctgcataataattaccaacataatgtttcatcagatcaaggttaaa |
8155253 |
T |
|
| Q |
370 |
tgtatgagatgttaatt |
386 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8155254 |
tgtatgagatgttaatt |
8155270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 420 - 496
Target Start/End: Original strand, 8155307 - 8155383
Alignment:
| Q |
420 |
tgacactagatgctaatatcatcttatttttagtatggatttgatagaattatttctagaaaggttagatcatgggt |
496 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8155307 |
tgacactagatgctaatatcatcttatttttagtatggatttgatagaattatttctagaaaggttagatcatgggt |
8155383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University