View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12770_low_12 (Length: 276)
Name: NF12770_low_12
Description: NF12770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12770_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 29 - 266
Target Start/End: Complemental strand, 3817512 - 3817268
Alignment:
| Q |
29 |
taggtctaatattttcttggtccatctttcaaatggtttatcaataacaaaaacaaataggattttgattatgttgtaagtaaatca----cctatggga |
124 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
3817512 |
taggtctaatattttcttggtcaatctttcaaatggtttatcaataacaaaaacaaataggattttgattatgttgtaagtaaatcaatcacctttggga |
3817413 |
T |
 |
| Q |
125 |
aatatgtagtgttattgttagcatcactgtctcataaaaagaatatctt---tattacatttgagggaggtcaaagaacactcaatgaaaagaatcacca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3817412 |
aatatgtagtgttattgttagcatcactgtctcataaaaagaatatcttctttattacatttgagggaggtcaaagaacactcaatgaaaagaatcacct |
3817313 |
T |
 |
| Q |
222 |
ctacaaagagaggatatcaaaattgtcaacaaatgaattcctttg |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3817312 |
ctacaaagagaggatatcaaaattgtcaacaaatgaattcctttg |
3817268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University