View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12770_low_14 (Length: 239)
Name: NF12770_low_14
Description: NF12770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12770_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 108; Significance: 2e-54; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 80 - 227
Target Start/End: Complemental strand, 36717348 - 36717201
Alignment:
| Q |
80 |
aaatcttcttcaattcacctcatggacattagggtcgaaacccttttctgatgttctgcttttttggctgtaggggttcttttgagtttcatcgactatt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| || |
|
|
| T |
36717348 |
aaatcttcttcaattcacctcatggacatcaaggtcctaacccttttctgatgttctgcttttttggctgtaggggttctcttgagtttcatcaactctt |
36717249 |
T |
 |
| Q |
180 |
gcttaacttcaccctcaattatatcaatcgaatgcaatagctgcttct |
227 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36717248 |
gcttcacttcacgctcaattatatcaatcgaatgcaatagcttcttct |
36717201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 143 - 230
Target Start/End: Complemental strand, 1482500 - 1482413
Alignment:
| Q |
143 |
ttggctgtaggggttcttttgagtttcatcgactattgcttaacttcaccctcaattatatcaatcgaatgcaatagctgcttcttct |
230 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1482500 |
ttggctgtaggggttctttttagtttcatcaactattgcttaacttcacgctcaattatatcaatcgaatgcaatagctgcttcttct |
1482413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 77 - 114
Target Start/End: Complemental strand, 1482623 - 1482586
Alignment:
| Q |
77 |
ttcaaatcttcttcaattcacctcatggacattagggt |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1482623 |
ttcaaatctttttcaattcacctcatggacattagggt |
1482586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 55
Target Start/End: Complemental strand, 19053009 - 19052972
Alignment:
| Q |
18 |
attctgtcaactctcaaaatagtttatcagtttaccaa |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19053009 |
attctgtcaactctcaaaatagtttatcagttcaccaa |
19052972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University