View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12770_low_9 (Length: 346)
Name: NF12770_low_9
Description: NF12770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12770_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 114 - 227
Target Start/End: Original strand, 36716422 - 36716535
Alignment:
| Q |
114 |
cttagctaatattctggttaactttgatcataaacgttcttttgagataatttgactagaatttgatttgaattgaatttgagaaacggtttatctttaa |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716422 |
cttagctaatattctggttagctttgatcataaacgttcttttgagataatttgactagaatttgatttgaattgaatttgagaaacggtttatctttaa |
36716521 |
T |
 |
| Q |
214 |
taattctaacgttc |
227 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
36716522 |
taaatctaacgttc |
36716535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 36716328 - 36716375
Alignment:
| Q |
20 |
aaccggtttatccttattcggttgttttgttcatttgtaatgcgatgc |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716328 |
aaccggtttatccttattcggttgttttgttcatttgtaatgcgatgc |
36716375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 303 - 346
Target Start/End: Original strand, 36716677 - 36716720
Alignment:
| Q |
303 |
ctttgataatactctgtttatggagttgagagaaatttctcttt |
346 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716677 |
ctttgctaatactctgtttatggagttgagagaaatttctcttt |
36716720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University