View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF12770_low_9 (Length: 346)

Name: NF12770_low_9
Description: NF12770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF12770_low_9
NF12770_low_9
[»] chr7 (3 HSPs)
chr7 (114-227)||(36716422-36716535)
chr7 (20-67)||(36716328-36716375)
chr7 (303-346)||(36716677-36716720)


Alignment Details
Target: chr7 (Bit Score: 106; Significance: 5e-53; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 114 - 227
Target Start/End: Original strand, 36716422 - 36716535
Alignment:
114 cttagctaatattctggttaactttgatcataaacgttcttttgagataatttgactagaatttgatttgaattgaatttgagaaacggtttatctttaa 213  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36716422 cttagctaatattctggttagctttgatcataaacgttcttttgagataatttgactagaatttgatttgaattgaatttgagaaacggtttatctttaa 36716521  T
214 taattctaacgttc 227  Q
    ||| ||||||||||    
36716522 taaatctaacgttc 36716535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 67
Target Start/End: Original strand, 36716328 - 36716375
Alignment:
20 aaccggtttatccttattcggttgttttgttcatttgtaatgcgatgc 67  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
36716328 aaccggtttatccttattcggttgttttgttcatttgtaatgcgatgc 36716375  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 303 - 346
Target Start/End: Original strand, 36716677 - 36716720
Alignment:
303 ctttgataatactctgtttatggagttgagagaaatttctcttt 346  Q
    ||||| ||||||||||||||||||||||||||||||||||||||    
36716677 ctttgctaatactctgtttatggagttgagagaaatttctcttt 36716720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University