View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12772_high_11 (Length: 259)
Name: NF12772_high_11
Description: NF12772
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12772_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 2 - 256
Target Start/End: Complemental strand, 26856518 - 26856264
Alignment:
| Q |
2 |
ttttccaatcagaagcccccaatgcaaacaaatcaaaatattgtcccaccataatgaatgaaaatggcataagaaactcattcataatagtcttggtctt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26856518 |
ttttccaatcagaagcccccaatgcaaaaaaatcaaaatattgtcccaccataatgaatgaaaatggcataagaaactcattcataatagtcttggtctt |
26856419 |
T |
|
| Q |
102 |
ttgtaccattgttgctcctaaacgaggtccatcaggagtaaccaaccctaaccagaaagatccattaacaattgctataccaaacatgtcagttataaat |
201 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| || |||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26856418 |
ttgtaccattgttgttcctaaacgaggtccatccggtgtaaccaaacccaaccagaaagacccattaacaattgctataccaaacatgtcagttataaat |
26856319 |
T |
|
| Q |
202 |
gccatcacaaaaacccctaaaataatagcaacaacaaaagattgatccacttctt |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26856318 |
gccatcacaaaaacccctaaaataatagcaacaacaaaagattgatccacttctt |
26856264 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University