View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12773_high_20 (Length: 233)
Name: NF12773_high_20
Description: NF12773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12773_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 497189 - 497037
Alignment:
| Q |
1 |
gctacacagattttcttgcaatttcccttcgtcctttaacaattttagcaacttggtcgttttctccctcgacgtttcattcactattctctccaatgta |
100 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
497189 |
gctacacatattttcttgcaatctcccttcgtcctttaacaattttagcaacttcgtcgttttctccctcgacgtttcattcactattccctccaatgta |
497090 |
T |
 |
| Q |
101 |
acctaaggatccctgtccttaggcgattttggtggtgacgttgaactgattgt |
153 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
497089 |
acctaaggatccctgtccttaggcgattttggtggtgctgttgaactgattgt |
497037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 146 - 224
Target Start/End: Complemental strand, 496494 - 496416
Alignment:
| Q |
146 |
ctgattgtaacctatgaaggttgctcattctgcctttcctccctcgcgctggaccccattctcttctcccatgtctctg |
224 |
Q |
| |
|
||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
496494 |
ctgattgtaacctatgaaggttgctcaatccgcctttcctccctcgcgctggaccccattctcttctcccatgtctctg |
496416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University