View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12773_low_14 (Length: 287)
Name: NF12773_low_14
Description: NF12773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12773_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 19 - 286
Target Start/End: Original strand, 34945063 - 34945335
Alignment:
| Q |
19 |
atccaaacatatttaagtagcttctcatatcaagtggttaaatttaagtgattagttagaccatgtttatatgaattcgatcattaggtaaacactagat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34945063 |
atccaaacatatttaagtagcttctcatatcaagtggttaaatttaagtgattagttagaccatgtttatatgaattcgatcattaggtaaacactagat |
34945162 |
T |
 |
| Q |
119 |
caaattttatttacattctaatcagtgtgatt-nnnnnnntctaagtaactcttcataaataatgatgaggatggtttttctttttggtgtaagcacaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34945163 |
caaattttatttacattctaatcagtgtgattaaaaaaaatctaagtaactcttcataaataatgatgaggatggtttttgtttttggtgtaagcacaaa |
34945262 |
T |
 |
| Q |
218 |
ggtgtgaccgt-ggggggaggagattc---tctcccattatttattctcatgtggaattgttgttgccctcca |
286 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34945263 |
ggtgtgaccgtgggggggaggagattcaattctcccattatttattctcatgtggaattgtggttgccctcca |
34945335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University