View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12773_low_16 (Length: 268)
Name: NF12773_low_16
Description: NF12773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12773_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 18 - 245
Target Start/End: Original strand, 3625813 - 3626041
Alignment:
| Q |
18 |
agaggaattatagttaacacaaatcatgacacattatcaatggctataattacttctatttatcaaagatcataatgtaacttcaatcattaattcaaaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3625813 |
agaggaattatagttaacacaaatcatgacacattatcaatggctataattacttctatttatcaaagatcataatgtaacttcaatcagtaattcaaaa |
3625912 |
T |
 |
| Q |
118 |
-ttaaatgatcactttataagccgcgtcgcggcatcaaattattttgatatttcgcgcgtgtgactatcatagttctaaattgcgctctgcaatcacaat |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3625913 |
attaaatgatcactttataagccgcgtcgcggcatcaaattattttgatatttcgcgcgtgtgactatcatagttctaaattgcgctctgcaatcacaat |
3626012 |
T |
 |
| Q |
217 |
tacaaccactatgcaaacagctgattttt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3626013 |
tacaaccactatgcaaacagctgattttt |
3626041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University