View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12773_low_18 (Length: 256)
Name: NF12773_low_18
Description: NF12773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12773_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 49693 - 49919
Alignment:
| Q |
18 |
caatgtagatacgaaattagaagatctcactaaccactgacgtttttctttttaatatcttcatgtttcacaccctgtaataatgacttataattaagta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
49693 |
caatgtagatacgaaattagaagatctcactaaccactgacgtttttctttttaatatcttcatgtttcacaccctgtaat---gacttataattaagta |
49789 |
T |
 |
| Q |
118 |
agtaaaaccgacctaagataaggaaaaaatgtagtgtatgcgtgtgtgtaatgtaaacgagattaaacctgatttgttgaagcagtgagatgttgttgag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49790 |
agtaaaaccgacctaagataaggaaaaaatgtagtgtatgcgtgtgtgtaatgtaaacgagattaaacctgatttgttgaagcagtgagatgttgttgag |
49889 |
T |
 |
| Q |
218 |
gtggccttagttttgtcctctttttgtcct |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49890 |
gtggccttagttttgtcctctttttgtcct |
49919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University