View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12773_low_22 (Length: 228)
Name: NF12773_low_22
Description: NF12773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12773_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 29662104 - 29662304
Alignment:
| Q |
16 |
acaatccaatcccaaaaacctttctcttgcttgctactgccaccacctgtagtaccctttgcacctgtagctgcaaagactcttcctgttgttggaacca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29662104 |
acaatccaatcccaaaaacctttctcttgcttgctactgccaccacctgtagtaccctttgcacctgtagctgcaaagactcttcccgttgttggaacca |
29662203 |
T |
 |
| Q |
116 |
ttggcaacatggtgatagaagccattaattctcctagcttaatttgaaaaattatatcaactag-aaactaaaatataatataaattctctttgcccagt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29662204 |
ttggcaacatggtgatagaagccattaattctcctagcttaatttgaaaaattatatcaactagaaaactaaaatataatataaattctctttgcctagt |
29662303 |
T |
 |
| Q |
215 |
g |
215 |
Q |
| |
|
| |
|
|
| T |
29662304 |
g |
29662304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University