View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12773_low_24 (Length: 222)
Name: NF12773_low_24
Description: NF12773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12773_low_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 185
Target Start/End: Original strand, 42622657 - 42622826
Alignment:
| Q |
16 |
aaggcacaatagccaaacgacgattgtcctcgtcgttttggtcctgattgtctgaataatcacattgttttgaccacgatagttgatctgtaattaatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622657 |
aaggcacaatagccaaacgacgattgtcctcctcgttttggtcctgattgtctgaataatcacattgttttgaccacgatagttgatctgtaattaatta |
42622756 |
T |
 |
| Q |
116 |
aaattaaatcaatataaaaatctactcaagataagatgtaaagcatgtttggataaacaacttatgtaag |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42622757 |
aaattaaatcaatataaaaatctactcaagataagatgtaaagcatgtttggataaacaacttatgtaag |
42622826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University