View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12773_low_26 (Length: 204)
Name: NF12773_low_26
Description: NF12773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12773_low_26 |
 |  |
|
| [»] chr8 (18 HSPs) |
 |  |
|
| [»] chr4 (27 HSPs) |
 |  |
|
| [»] chr3 (18 HSPs) |
 |  |
|
| [»] chr6 (9 HSPs) |
 |  |
|
| [»] chr7 (9 HSPs) |
 |  |
|
| [»] chr2 (11 HSPs) |
 |  |
|
| [»] scaffold0172 (1 HSPs) |
 |  |
|
| [»] chr5 (8 HSPs) |
 |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 20)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 34945340 - 34945475
Alignment:
| Q |
1 |
catgagagagtgtgtgtttaacattaaaaaggagagaagggagtgtacataaggatgaggatacaactaccacaaaatatagtactagattattttcaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
34945340 |
catgagagagtgtgtgtttaacattaaaaaggagaaaaaggagtgtacataagggtgaggatacaaccaccacaaa--atagtactagattattttcaat |
34945437 |
T |
 |
| Q |
101 |
ggcgaaggattcactccgatgctttggtataaaagaaa |
138 |
Q |
| |
|
|| |||||||||||||| || |||||||||||||||| |
|
|
| T |
34945438 |
ggtgaaggattcactccagtggtttggtataaaagaaa |
34945475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 43196141 - 43196102
Alignment:
| Q |
165 |
tccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
43196141 |
tccattttgctacaactttttgacaattttctctctcata |
43196102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 2257745 - 2257707
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
2257745 |
ccattttgctacaactttttaacaactttctctctcata |
2257707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 7203895 - 7203857
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
7203895 |
ccattttgcaacaatttttagacaactttctctctcata |
7203857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 9445128 - 9445166
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
9445128 |
ccattttgtaacaactttttgacaactttctctttcata |
9445166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 18541102 - 18541064
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
18541102 |
ccattttctaacaactttttgacaactttctctctcata |
18541064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 39815366 - 39815404
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
39815366 |
ccattttgctacaacttttggacaactttctctctcata |
39815404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 49189259 - 49189221
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
49189259 |
ccattttgctacaactttttgacaactttctttctcata |
49189221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 1156500 - 1156537
Alignment:
| Q |
167 |
cattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |
|
|
| T |
1156500 |
cattttgcaataattttttgacaactttctctctcata |
1156537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 21441665 - 21441694
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21441665 |
aacaactttttgacaactttctctctcata |
21441694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 21728276 - 21728247
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
21728276 |
aacaactttttgacaactttctctctcata |
21728247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 24611873 - 24611902
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
24611873 |
aacaactttttgacaactttctctctcata |
24611902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 27810289 - 27810260
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
27810289 |
aacaactttttgacaactttctctctcata |
27810260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 5368082 - 5368054
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5368082 |
acaactttttgacaactttctctctcata |
5368054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 33422260 - 33422232
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33422260 |
acaactttttgacaactttctctctcata |
33422232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 39010844 - 39010872
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39010844 |
acaactttttgacaactttctctctcata |
39010872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 50017464 - 50017436
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50017464 |
acaactttttgacaactttctctctcata |
50017436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 50141976 - 50141948
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50141976 |
acaactttttgacaactttctctctcata |
50141948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 50226920 - 50226892
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50226920 |
acaactttttgacaactttctctctcata |
50226892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 52417561 - 52417589
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52417561 |
acaactttttgacaactttctctctcata |
52417589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 18)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 11114721 - 11114682
Alignment:
| Q |
165 |
tccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
11114721 |
tccattttgcaataactttttgacaactttctctctcata |
11114682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 29509286 - 29509324
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29509286 |
ccattttgctacaactttttgacaactttctctctcata |
29509324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 169 - 204
Target Start/End: Original strand, 34970230 - 34970265
Alignment:
| Q |
169 |
ttttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34970230 |
ttttgtaacaactttttgacaactttctctctcata |
34970265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 8888272 - 8888310
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8888272 |
ccattttgcaacaactttcagacaactttctctctcata |
8888310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 42131016 - 42131054
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
42131016 |
ccattctgcaacaacttttggacaactttctctctcata |
42131054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 43587661 - 43587699
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
43587661 |
ccattttgctacaactttttgacaattttctctctcata |
43587699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 9550449 - 9550420
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9550449 |
aacaactttttgacaactttctctctcata |
9550420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 12659081 - 12659110
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12659081 |
aacaactttttgacaactttctctctcata |
12659110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 24116061 - 24116098
Alignment:
| Q |
167 |
cattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
24116061 |
cattttgcaacaattttttgacaactttctttctcata |
24116098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 166 - 203
Target Start/End: Complemental strand, 35937563 - 35937526
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcat |
203 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
35937563 |
ccattttgtaacaacttttggacaactttctctctcat |
35937526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 6105477 - 6105449
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6105477 |
acaactttttgacaactttctctctcata |
6105449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 11879531 - 11879503
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11879531 |
acaactttttgacaactttctctctcata |
11879503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 11896947 - 11896919
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
11896947 |
acaactttttgacaactttctctctcata |
11896919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 35634010 - 35633982
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35634010 |
acaactttttgacaactttctctctcata |
35633982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 35967447 - 35967419
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35967447 |
acaactttttgacaactttctctctcata |
35967419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 37210090 - 37210062
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37210090 |
acaactttttgacaactttctctctcata |
37210062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 40102053 - 40102081
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40102053 |
acaactttttgacaactttctctctcata |
40102081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 45101426 - 45101454
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45101426 |
acaactttttgacaactttctctctcata |
45101454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 27)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 48722088 - 48722127
Alignment:
| Q |
165 |
tccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48722088 |
tccattttgcaacaactttttgacaattttctctctcata |
48722127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 49768921 - 49768882
Alignment:
| Q |
165 |
tccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49768921 |
tccattttgcaacaattttttgacaactttctctctcata |
49768882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 29513747 - 29513709
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29513747 |
ccattttgctacaactttttgacaactttctctctcata |
29513709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 51224889 - 51224851
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51224889 |
ccattttgctacaactttttgacaactttctctctcata |
51224851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 56025276 - 56025314
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
56025276 |
ccattttgctacaactttttgacaactttctctctcata |
56025314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 169 - 204
Target Start/End: Complemental strand, 49424868 - 49424833
Alignment:
| Q |
169 |
ttttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
49424868 |
ttttgtaacaactttttgacaactttctctctcata |
49424833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 1562587 - 1562549
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1562587 |
ccattttctaacaactttttgacaactttctctctcata |
1562549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 6239400 - 6239438
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
6239400 |
ccattttgcaataattttttgacaactttctctctcata |
6239438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 36081819 - 36081857
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
36081819 |
ccattttgctacaacttttggacaactttctctctcata |
36081857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 45286166 - 45286128
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45286166 |
ccattttgcaacaactttcagacaactttctctctcata |
45286128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 47998614 - 47998652
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
47998614 |
ccattttgtaacaactttttgacaactttttctctcata |
47998652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 12241087 - 12241116
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
12241087 |
aacaactttttgacaactttctctctcata |
12241116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 204
Target Start/End: Original strand, 31048909 - 31048946
Alignment:
| Q |
167 |
cattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31048909 |
cattttgctgcaactttttgacaactttctctctcata |
31048946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 33820378 - 33820349
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33820378 |
aacaactttttgacaactttctctctcata |
33820349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 39881072 - 39881043
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39881072 |
aacaactttttgacaactttctctctcata |
39881043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 167 - 204
Target Start/End: Complemental strand, 53763861 - 53763824
Alignment:
| Q |
167 |
cattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
53763861 |
cattttgctacaacttttggacaactttctctctcata |
53763824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 55595978 - 55596007
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55595978 |
aacaactttttgacaactttctctctcata |
55596007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 2812634 - 2812606
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2812634 |
acaactttttgacaactttctctctcata |
2812606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 17363260 - 17363288
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
17363260 |
acaactttttgacaactttctctctcata |
17363288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 25523239 - 25523211
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
25523239 |
acaactttttgacaactttctctctcata |
25523211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 31275176 - 31275204
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
31275176 |
acaactttttgacaactttctctctcata |
31275204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 37514184 - 37514144
Alignment:
| Q |
165 |
tccattttgcaacaactttt-tgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
37514184 |
tccattttgtaacaacttttgtgacaactttctctctcata |
37514144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 45274295 - 45274323
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45274295 |
acaactttttgacaactttctctctcata |
45274323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 46794542 - 46794514
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46794542 |
acaactttttgacaactttctctctcata |
46794514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 46844290 - 46844254
Alignment:
| Q |
168 |
attttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
46844290 |
attttgtaacaattttttgacaactttctctctcata |
46844254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 46911928 - 46911956
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
46911928 |
acaactttttgacaactttctctctcata |
46911956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 53583169 - 53583141
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
53583169 |
acaactttttgacaactttctctctcata |
53583141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 18)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 30805655 - 30805616
Alignment:
| Q |
165 |
tccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
30805655 |
tccattttgcaacaactttttgacaacttcctctctcata |
30805616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 41877708 - 41877746
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41877708 |
ccattttgctacaactttttgacaactttctctctcata |
41877746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 7949811 - 7949849
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
7949811 |
ccattttgctacaactttttgacaactttctttctcata |
7949849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 11335353 - 11335315
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11335353 |
ccattttctaacaactttttgacaactttctctctcata |
11335315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 40478338 - 40478300
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
40478338 |
ccattttgctacaactttttgacaactttctatctcata |
40478300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 47056577 - 47056539
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
47056577 |
ccattttgcaacaatttttggacaactttctctctcata |
47056539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 32008062 - 32008091
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32008062 |
aacaactttttgacaactttctctctcata |
32008091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 47988527 - 47988498
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47988527 |
aacaactttttgacaactttctctctcata |
47988498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 47997814 - 47997785
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
47997814 |
aacaactttttgacaactttctctctcata |
47997785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 48007101 - 48007072
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48007101 |
aacaactttttgacaactttctctctcata |
48007072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 48649609 - 48649638
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48649609 |
aacaactttttgacaactttctctctcata |
48649638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 622501 - 622473
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
622501 |
acaactttttgacaactttctctctcata |
622473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 6126484 - 6126512
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6126484 |
acaactttttgacaactttctctctcata |
6126512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 8066385 - 8066413
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8066385 |
acaactttttgacaactttctctctcata |
8066413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 26279914 - 26279942
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26279914 |
acaactttttgacaactttctctctcata |
26279942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 37303115 - 37303087
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37303115 |
acaactttttgacaactttctctctcata |
37303087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 43900798 - 43900770
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43900798 |
acaactttttgacaactttctctctcata |
43900770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 44334842 - 44334814
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44334842 |
acaactttttgacaactttctctctcata |
44334814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.00000000007; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 25924915 - 25924877
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25924915 |
ccattttgctacaactttttgacaactttctctctcata |
25924877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 28965891 - 28965853
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28965891 |
ccattttgttacaactttttgacaactttctctctcata |
28965853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 14094940 - 14094969
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14094940 |
aacaactttttgacaactttctctctcata |
14094969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 17835641 - 17835670
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17835641 |
aacaactttttgacaactttctctctcata |
17835670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 8395372 - 8395400
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8395372 |
acaactttttgacaactttctctctcata |
8395400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 9954578 - 9954606
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9954578 |
acaactttttgacaactttctctctcata |
9954606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 19789117 - 19789089
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
19789117 |
acaactttttgacaactttctctctcata |
19789089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 21506366 - 21506394
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21506366 |
acaactttttgacaactttctctctcata |
21506394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 29383587 - 29383615
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29383587 |
acaactttttgacaactttctctctcata |
29383615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 9)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 1790013 - 1790049
Alignment:
| Q |
168 |
attttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
1790013 |
attttgcgacaactttttgacaactttctctctcata |
1790049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 16645730 - 16645692
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16645730 |
ccattttgctacaattttttgacaactttctctctcata |
16645692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 17620091 - 17620053
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
17620091 |
ccattttgctacaattttttgacaactttctctctcata |
17620053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 19426600 - 19426638
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19426600 |
ccattttgtgacaactttttgacaactttctctctcata |
19426638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 42060676 - 42060714
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
42060676 |
ccattttgctataactttttgacaactttctctctcata |
42060714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 9055296 - 9055325
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9055296 |
aacaactttttgacaactttctctctcata |
9055325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 5378657 - 5378685
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5378657 |
acaactttttgacaactttctctctcata |
5378685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 28824533 - 28824561
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
28824533 |
acaactttttgacaactttctctctcata |
28824561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 29609905 - 29609877
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29609905 |
acaactttttgacaactttctctctcata |
29609877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 168 - 204
Target Start/End: Complemental strand, 6851708 - 6851672
Alignment:
| Q |
168 |
attttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6851708 |
attttgctacaactttttgacaactttctctctcata |
6851672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 165 - 204
Target Start/End: Original strand, 5606593 - 5606632
Alignment:
| Q |
165 |
tccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
5606593 |
tccattttgcaacaactttttgataattttctctctcata |
5606632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 30413777 - 30413739
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
30413777 |
ccattttgctacaactttttgacaactttatctctcata |
30413739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Complemental strand, 31635861 - 31635823
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31635861 |
ccattttctaacaactttttgacaactttctctctcata |
31635823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 14797692 - 14797663
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14797692 |
aacaactttttgacaactttctctctcata |
14797663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Complemental strand, 41868411 - 41868382
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
41868411 |
aacaactttttgacaactttctctctcata |
41868382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 7086165 - 7086137
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7086165 |
acaactttttgacaactttctctctcata |
7086137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 7498032 - 7498004
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7498032 |
acaactttttgacaactttctctctcata |
7498004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 27540037 - 27540073
Alignment:
| Q |
168 |
attttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
27540037 |
attttgctacaactttttgacaactttttctctcata |
27540073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 42665853 - 42665825
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42665853 |
acaactttttgacaactttctctctcata |
42665825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 43650590 - 43650562
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43650590 |
acaactttttgacaactttctctctcata |
43650562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0172 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0172
Description:
Target: scaffold0172; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 16995 - 17033
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
16995 |
ccattttactacaactttttgacaactttctctctcata |
17033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 8)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 166 - 204
Target Start/End: Original strand, 31708390 - 31708428
Alignment:
| Q |
166 |
ccattttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31708390 |
ccattttataacaactttttgacaactttctctctcata |
31708428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 175 - 204
Target Start/End: Original strand, 6046342 - 6046371
Alignment:
| Q |
175 |
aacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6046342 |
aacaactttttgacaactttctctctcata |
6046371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 21023328 - 21023356
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21023328 |
acaactttttgacaactttctctctcata |
21023356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 31006081 - 31006117
Alignment:
| Q |
168 |
attttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
31006081 |
attttgctaaaactttttgacaactttctctctcata |
31006117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 34381042 - 34381070
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34381042 |
acaactttttgacaactttctctctcata |
34381070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 39595302 - 39595330
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
39595302 |
acaactttttgacaactttctctctcata |
39595330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Complemental strand, 40223826 - 40223798
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40223826 |
acaactttttgacaactttctctctcata |
40223798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 168 - 204
Target Start/End: Original strand, 41192609 - 41192645
Alignment:
| Q |
168 |
attttgcaacaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
41192609 |
attttgctacaattttttgacaactttctctctcata |
41192645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 176 - 204
Target Start/End: Original strand, 6847 - 6875
Alignment:
| Q |
176 |
acaactttttgacaactttctctctcata |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6847 |
acaactttttgacaactttctctctcata |
6875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University