View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12776_high_9 (Length: 404)
Name: NF12776_high_9
Description: NF12776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12776_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 48818317 - 48818545
Alignment:
| Q |
1 |
gttcgtcagaaccatcatcgagtcttatcttctctctatcgccaccgacgcagacaaaccccctcaagaaccaccgcaagagacacccaaggaagttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818317 |
gttcgtcagaaccatcatcgagtcttatcttctctctatcgccaccgacgcagacaaaccccctcaagaaccaccgcaagagacacccaaggaagttgaa |
48818416 |
T |
 |
| Q |
101 |
ccaccacaaccccaagagttcaataaggtggtgggtgtcaaacgcaaaaacgacgattcagaagacgttatttgccaggttaaccagtcactcttatttt |
200 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818417 |
ccaccacaaccacaagagttcaataaggtggtgggtgtcaaacgcaaaaacgacgattcagaagacgttatttgccaggttaaccagtcactcttatttt |
48818516 |
T |
 |
| Q |
201 |
caatccttaaacttattagtatttcatgg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
48818517 |
caatccttaaacttattagtatttcatgg |
48818545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 310 - 384
Target Start/End: Original strand, 48818625 - 48818699
Alignment:
| Q |
310 |
gatgctagtcattgctcttaatagatgttgcttgtttgatatgtagctatcagccaggaggaatgtggcggttcg |
384 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48818625 |
gatgctagtcattgctcttaatagatgttgcttgtttgatatgtagctatcagccaggaggaatgtggcggttcg |
48818699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University