View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF12776_low_16 (Length: 250)
Name: NF12776_low_16
Description: NF12776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF12776_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 240
Target Start/End: Complemental strand, 37066496 - 37066275
Alignment:
| Q |
19 |
tcttccacattggaccaaggtgaaaacccagttgccatttcaacaatagtgcaaccaagtgaccaaacatcacaagggaacccttgttcttcgctgcgcg |
118 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
37066496 |
tcttccacattggaccaaggtgaaaaaccagttgccatttcaacaatagtgcaaccaagtgaccaaacatcacaagggaacccttgttcttcgccgcgcg |
37066397 |
T |
 |
| Q |
119 |
ccacctccggcgccatatacatcggtgttccggcagccggcacaatttcatcgatcatctttgcacaaccaaagtctccaattttaactcctttttcaca |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37066396 |
ccacctccggcgccatatacatcggtgttccggcagctggcgcaatttcatcgatcatctttgcacaaccaaagtctcctattttaactcctttttcaca |
37066297 |
T |
 |
| Q |
219 |
taccaatatgttactacctttg |
240 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37066296 |
taccaatatgttactacctttg |
37066275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 37 - 110
Target Start/End: Original strand, 17501263 - 17501336
Alignment:
| Q |
37 |
ggtgaaaacccagttgccatttcaacaatagtgcaaccaagtgaccaaacatcacaagggaacccttgttcttc |
110 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||||||||||||||| ||||| || ||| |||||||||| |
|
|
| T |
17501263 |
ggtgaagaaccagttgccatttcaattatagtgcaaccaagtgaccaaatatcactagaaaactcttgttcttc |
17501336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University